Excercises/Python_course_exercises_A.ipynb

+%% Cell type:markdown id: tags:
+
+# Python course 2021 - Exercises A
+
+%% Cell type:markdown id: tags:
+
+## Part1 - Variables
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+
+
+1.1) Save 3.14159265359 in a variable of type float!
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+
+1.2) Convert variable from float to integer!
+
+
+
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+
+1.3) Convert variable back! What happens?
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+1.4) Convert variable type to string!
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+
+1.5) Save 'Python' in a string variable!
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+1.6) Convert variable type to float! What happens?
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+
+
+1.7) What is a pitfall in regards to division when working with int/float?
+
+%% Cell type:markdown id: tags:
+
+---type your answer here (double click)---
+
+%% Cell type:markdown id: tags:
+
+## Part2 - Functions
+
+%% Cell type:markdown id: tags:
+
+Primer: 'ATGCCATGCATTCGACTACG'
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+
+
+2.1) Calculate length of primer and print it!
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+
+2.2) Get number of 'G's and print it!
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+2.3) Write a function to analyze the nucleotide composition of a primer and print it!
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+2.4) Is it a suitable primer? Why (not)?
+
+%% Cell type:markdown id: tags:
+
+---type your answer here (double click)---

Excercises/Python_course_exercises_D_part2.ipynb

+%% Cell type:markdown id: tags:
+
+## Part2 - characters
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+2.1) Read the file AtCol0_Exons.fasta and write the following:
+*   Only Arabidopsis Gene Identifier (e.g. AT1G01010)
+*   Gene Identifier, exon name, exon length (tab-delimited)
+
+
+
+%% Cell type:code id: tags:
+
+``` 
+```

Excercises/Python_course_exercises_E.ipynb

+%% Cell type:markdown id: tags:
+
+# Python course 2021 - Exercises E
+
+%% Cell type:markdown id: tags:
+
+## Part1 - modules
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+1.1) Write all AGIs of AtCol0_exons.fasta into a new file!
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+1.2) Some IDs occur multiple times. Add a filter step to reduce the results to unique IDs!
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+1.3) Calculate the frequency of each AGI and construct a histogram (matplotlib)!
+```
+plt.hist(<list_of_values>)    #tip
+```
+
+
+
+%% Cell type:code id: tags:
+
+``` 
+
+```