Compare revisions

dfaf1f44 · dfaf1f44 · dfaf1f44 · dfaf1f44 · dfaf1f44 · dfaf1f44
--- a/Excercises/Python_course_exercises_F.ipynb
+++ b/Excercises/Python_course_exercises_F.ipynb
+%% Cell type:markdown id: tags:
+
+# Python course 2021 - Exercises F
+
+%% Cell type:markdown id: tags:
+
+## Part1 - DNA, RNA and peptide sequences
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+1.1) Write a function to get the reverse complement (upper case letters) of a DNA sequence given in upper case letters!
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+1.2) Write a function to convert a DNA sequence into a RNA sequence!
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+1.3) Write a function to translate a DNA sequence into amino acids (first frame only)!
+* Tip: [wiki - codon tables](https://en.wikipedia.org/wiki/DNA_and_RNA_codon_tables)
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+1.4) Write a function to translate DNA sequences in all 6 frames into peptide sequences! The longest peptide sequence per DNA sequence should be returned!
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
+%% Cell type:markdown id: tags:
+
+# Python course 2021 - Exercises F
+
+%% Cell type:markdown id: tags:
+
+## Part1 - DNA, RNA and peptide sequences
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+1.1) Write a function to get the reverse complement (upper case letters) of a DNA sequence given in upper case letters!
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+1.2) Write a function to convert a DNA sequence into a RNA sequence!
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+1.3) Write a function to translate a DNA sequence into amino acids (first frame only)!
+* Tip: [wiki - codon tables](https://en.wikipedia.org/wiki/DNA_and_RNA_codon_tables)
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
+
+%% Cell type:markdown id: tags:
+
+
+
+---
+1.4) Write a function to translate DNA sequences in all 6 frames into peptide sequences! The longest peptide sequence per DNA sequence should be returned!
+
+%% Cell type:code id: tags:
+
+``` 
+
+```
--- a/Excercises/gap_exercise1_basics.ipynb
+++ b/Excercises/gap_exercise1_basics.ipynb
+%% Cell type:markdown id: tags:
+
+# Python course - Exercises Gap text
+
+%% Cell type:markdown id: tags:
+
+Correct the Code
+
+%% Cell type:code id: tags:
+
+``` 
+# What is missing here? Expected output: Hi!
+    ('Hi!')
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Here are two mistakes. Can you find them?
+    Hi! I am a comment. How are you?
+
+    print('Hello world!')
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Multi-line comments
+
+I want to be a
+mutli line comment.
+"""
+print('Hello world!')
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Expected output: 5
+c = 5
+print(     )
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# How to print two strings as one. Expected output: Hello world
+a = 'Hello'
+b = 'world'
+print( a   b )
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Variable types
+# Does the error output help you?
+a = 'Hello'
+b =   0
+print( a + b )
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# What is missing?
+a = 'Hello'
+b = a
+
+if a == b:
+print('Same!')
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Print the variable type
+# Expected output: a is of type <class 'str'>
+a = 'How are you?
+print('a is of type',     (a))
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Variable names: What is allowed and what not?
+_1th_string   = "Hello"
+second_string = 'world'
+3rd_string    = '!'
+FOURTH_STRING = 'How'
+FIFTH STRING  = 'are'
+_6th-string   = 'you?'
+
+print(_1th_string, second_string,
+      3rd_string, FOURTH_STRING,
+      FIFTH STRING, _6th-string
+      )
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# convert b into float
+a = 2
+b =     (a)
+print(b)
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# How to access Lists?
+my_list = ["!", "Hello", 'you', "How", '?', 1, 'are', 2, 3, "world"]
+print(my_list)
+print(my_list[  ]) # print '!'
+print(my_list[  ]) # print 'Hello'
+print(my_list[  ]) # print the last element of a list without the real index; here 'world'
+### print 'Hello world! How are you?':
+print(my_list[  ], my_list[  ] ,my_list[0] ,my_list[  ] ,my_list[  ] ,my_list[  ], my_list[4])
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Indices of Strings
+a = 'Hello world!'
+print(a[  ]) # only print !
+print(a[  ]) # only print H
+print(a[  ]) # only print 'world', without '!'
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Dictionaries
+my_dict = { 'chr1' : 'gene1', 'chr2' : 'gene3' }
+print(my_dict[   ]) # print gene1 of the dictionary
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Dictionaries2; Find the mistake
+my_dict = { 'chr1' : 'gene1', 'chr1' : 'gene3' }
+print(my_dict[   ]) # print gene1 of the dictionary
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Dictionaries3
+my_dict = { 'chr1' : ['gene1', 'gene2'], 'chr2' : 'gene3' }
+print(my_dict[   ][  ]) # print gene2 of the dictionary
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Booleans
+a = 0
+b = 1
+print(bool(   )) # print True; insert the right variable
+print(bool(   )) # print False; insert the right variable
+```
+%% Cell type:markdown id: tags:
+
+# Python course - Exercises Gap text
+
+%% Cell type:markdown id: tags:
+
+Correct the Code
+
+%% Cell type:code id: tags:
+
+``` 
+# What is missing here? Expected output: Hi!
+    ('Hi!')
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Here are two mistakes. Can you find them?
+    Hi! I am a comment. How are you?
+
+    print('Hello world!')
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Multi-line comments
+
+I want to be a
+mutli line comment.
+"""
+print('Hello world!')
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Expected output: 5
+c = 5
+print(     )
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# How to print two strings as one. Expected output: Hello world
+a = 'Hello'
+b = 'world'
+print( a   b )
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Variable types
+# Does the error output help you?
+a = 'Hello'
+b =   0
+print( a + b )
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# What is missing?
+a = 'Hello'
+b = a
+
+if a == b:
+print('Same!')
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Print the variable type
+# Expected output: a is of type <class 'str'>
+a = 'How are you?
+print('a is of type',     (a))
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Variable names: What is allowed and what not?
+_1th_string   = "Hello"
+second_string = 'world'
+3rd_string    = '!'
+FOURTH_STRING = 'How'
+FIFTH STRING  = 'are'
+_6th-string   = 'you?'
+
+print(_1th_string, second_string,
+      3rd_string, FOURTH_STRING,
+      FIFTH STRING, _6th-string
+      )
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# convert b into float
+a = 2
+b =     (a)
+print(b)
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# How to access Lists?
+my_list = ["!", "Hello", 'you', "How", '?', 1, 'are', 2, 3, "world"]
+print(my_list)
+print(my_list[  ]) # print '!'
+print(my_list[  ]) # print 'Hello'
+print(my_list[  ]) # print the last element of a list without the real index; here 'world'
+### print 'Hello world! How are you?':
+print(my_list[  ], my_list[  ] ,my_list[0] ,my_list[  ] ,my_list[  ] ,my_list[  ], my_list[4])
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Indices of Strings
+a = 'Hello world!'
+print(a[  ]) # only print !
+print(a[  ]) # only print H
+print(a[  ]) # only print 'world', without '!'
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Dictionaries
+my_dict = { 'chr1' : 'gene1', 'chr2' : 'gene3' }
+print(my_dict[   ]) # print gene1 of the dictionary
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Dictionaries2; Find the mistake
+my_dict = { 'chr1' : 'gene1', 'chr1' : 'gene3' }
+print(my_dict[   ]) # print gene1 of the dictionary
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Dictionaries3
+my_dict = { 'chr1' : ['gene1', 'gene2'], 'chr2' : 'gene3' }
+print(my_dict[   ][  ]) # print gene2 of the dictionary
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# Booleans
+a = 0
+b = 1
+print(bool(   )) # print True; insert the right variable
+print(bool(   )) # print False; insert the right variable
+```
--- a/Excercises/gap_exercise2_functions.ipynb
+++ b/Excercises/gap_exercise2_functions.ipynb
+%% Cell type:markdown id: tags:
+
+# Python course - Exercises Gap text
+
+%% Cell type:markdown id: tags:
+
+Correct the Code
+
+%% Cell type:code id: tags:
+
+``` 
+# How are functions defined?
+    my_function(b):
+  print(b+10)
+
+a=5
+my_function(a)
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# What is missing?
+   concat_sequences( seq1, seq2, seq3 ):
+  print(seq1 + seq2 + seq3)
+
+concat_sequences('ACGTC', 'GTCAA')
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# correct the code such that the function delivers b+10
+   my_function(b):
+       (b+10)
+
+result = my_function(5)
+print( result)
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# undefined number of arguments: what is needed?
+   concat_sequences( seq ):
+  print(seq[0] + seq[1] + seq[2])
+
+concat_sequences('ACGTC', 'GTCAA', 'TAGCTGC')
+```
+%% Cell type:markdown id: tags:
+
+# Python course - Exercises Gap text
+
+%% Cell type:markdown id: tags:
+
+Correct the Code
+
+%% Cell type:code id: tags:
+
+``` 
+# How are functions defined?
+    my_function(b):
+  print(b+10)
+
+a=5
+my_function(a)
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# What is missing?
+   concat_sequences( seq1, seq2, seq3 ):
+  print(seq1 + seq2 + seq3)
+
+concat_sequences('ACGTC', 'GTCAA')
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# correct the code such that the function delivers b+10
+   my_function(b):
+       (b+10)
+
+result = my_function(5)
+print( result)
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# undefined number of arguments: what is needed?
+   concat_sequences( seq ):
+  print(seq[0] + seq[1] + seq[2])
+
+concat_sequences('ACGTC', 'GTCAA', 'TAGCTGC')
+```
--- a/Excercises/gap_exercise3_if_else.ipynb
+++ b/Excercises/gap_exercise3_if_else.ipynb
+%% Cell type:markdown id: tags:
+
+# Python course - Exercises Gap text
+
+%% Cell type:markdown id: tags:
+
+Correct the Code
+
+%% Cell type:code id: tags:
+
+``` 
+# complete the statement for b larger than a
+a = 5
+b = 10
+
+   b   a:
+   print('b larger a')
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# complete the statements
+a = 5
+b = 10
+c = 5
+
+   (a  b)  (a  c):
+   print('a smaller b, but a equals c')
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# complete the statements
+a = 5
+b = 10
+c = 5
+
+  a   c:
+   print('a smaller or equal c')
+  a   b:
+  print('a larger or equal b')
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# complete the statements
+a = 5
+b = 10
+c = 5
+
+   a    c:
+   print('a not c')
+   a    b:
+  print('a equals b')
+
+  print('None of the above is true')
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# complete the statements
+a = 5
+b = 10
+c = 5
+
+   (a   c)    (b    c):
+   print('a not c OR b not c')
+
+  print('None of the above is true')
+```
+%% Cell type:markdown id: tags:
+
+# Python course - Exercises Gap text
+
+%% Cell type:markdown id: tags:
+
+Correct the Code
+
+%% Cell type:code id: tags:
+
+``` 
+# complete the statement for b larger than a
+a = 5
+b = 10
+
+   b   a:
+   print('b larger a')
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# complete the statements
+a = 5
+b = 10
+c = 5
+
+   (a  b)  (a  c):
+   print('a smaller b, but a equals c')
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# complete the statements
+a = 5
+b = 10
+c = 5
+
+  a   c:
+   print('a smaller or equal c')
+  a   b:
+  print('a larger or equal b')
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# complete the statements
+a = 5
+b = 10
+c = 5
+
+   a    c:
+   print('a not c')
+   a    b:
+  print('a equals b')
+
+  print('None of the above is true')
+```
+
+%% Cell type:code id: tags:
+
+``` 
+# complete the statements
+a = 5
+b = 10
+c = 5
+
+   (a   c)    (b    c):
+   print('a not c OR b not c')
+
+  print('None of the above is true')
+```
--- a/README.md
+++ b/README.md
-# Python programming
+# Applied Python Programming for Life Scientists

-This course teaches the basics of programming using the user-friendly script language Python. Participants learn the basics of Python syntax by theoretical examples and by applying their new knowledge through the development of their very own scripts
-
-## Getting started
-
-To make it easy for you to get started with GitLab, here's a list of recommended next steps.
-
-Already a pro? Just edit this README.md and make it your own. Want to make it easy? [Use the template at the bottom](#editing-this-readme)!
-
-## Add your files
-
- [ ] [Create](https://docs.gitlab.com/ee/user/project/repository/web_editor.html#create-a-file) or [upload](https://docs.gitlab.com/ee/user/project/repository/web_editor.html#upload-a-file) files
- [ ] [Add files using the command line](https://docs.gitlab.com/ee/gitlab-basics/add-file.html#add-a-file-using-the-command-line) or push an existing Git repository with the following command:
-
-```
-cd existing_repo
-git remote add origin https://gitlab.ub.uni-bielefeld.de/ggp_python/python-programming.git
-git branch -M main
-git push -uf origin main
-```
-
-## Integrate with your tools
-
- [ ] [Set up project integrations](https://gitlab.ub.uni-bielefeld.de/ggp_python/python-programming/-/settings/integrations)
-
-## Collaborate with your team
-
- [ ] [Invite team members and collaborators](https://docs.gitlab.com/ee/user/project/members/)
- [ ] [Create a new merge request](https://docs.gitlab.com/ee/user/project/merge_requests/creating_merge_requests.html)
- [ ] [Automatically close issues from merge requests](https://docs.gitlab.com/ee/user/project/issues/managing_issues.html#closing-issues-automatically)
- [ ] [Enable merge request approvals](https://docs.gitlab.com/ee/user/project/merge_requests/approvals/)
- [ ] [Automatically merge when pipeline succeeds](https://docs.gitlab.com/ee/user/project/merge_requests/merge_when_pipeline_succeeds.html)
-
-## Test and Deploy
-
-Use the built-in continuous integration in GitLab.
-
- [ ] [Get started with GitLab CI/CD](https://docs.gitlab.com/ee/ci/quick_start/index.html)
- [ ] [Analyze your code for known vulnerabilities with Static Application Security Testing(SAST)](https://docs.gitlab.com/ee/user/application_security/sast/)
- [ ] [Deploy to Kubernetes, Amazon EC2, or Amazon ECS using Auto Deploy](https://docs.gitlab.com/ee/topics/autodevops/requirements.html)
- [ ] [Use pull-based deployments for improved Kubernetes management](https://docs.gitlab.com/ee/user/clusters/agent/)
- [ ] [Set up protected environments](https://docs.gitlab.com/ee/ci/environments/protected_environments.html)
-
-***
-
-# Editing this README
-
-When you're ready to make this README your own, just edit this file and use the handy template below (or feel free to structure it however you want - this is just a starting point!).  Thank you to [makeareadme.com](https://www.makeareadme.com/) for this template.
-
-## Suggestions for a good README
-Every project is different, so consider which of these sections apply to yours. The sections used in the template are suggestions for most open source projects. Also keep in mind that while a README can be too long and detailed, too long is better than too short. If you think your README is too long, consider utilizing another form of documentation rather than cutting out information.
-
-## Name
-Choose a self-explaining name for your project.
-
-## Description
-Let people know what your project can do specifically. Provide context and add a link to any reference visitors might be unfamiliar with. A list of Features or a Background subsection can also be added here. If there are alternatives to your project, this is a good place to list differentiating factors.
-
-## Badges
-On some READMEs, you may see small images that convey metadata, such as whether or not all the tests are passing for the project. You can use Shields to add some to your README. Many services also have instructions for adding a badge.
-
-## Visuals
-Depending on what you are making, it can be a good idea to include screenshots or even a video (you'll frequently see GIFs rather than actual videos). Tools like ttygif can help, but check out Asciinema for a more sophisticated method.
-
-## Installation
-Within a particular ecosystem, there may be a common way of installing things, such as using Yarn, NuGet, or Homebrew. However, consider the possibility that whoever is reading your README is a novice and would like more guidance. Listing specific steps helps remove ambiguity and gets people to using your project as quickly as possible. If it only runs in a specific context like a particular programming language version or operating system or has dependencies that have to be installed manually, also add a Requirements subsection.
-
-## Usage
-Use examples liberally, and show the expected output if you can. It's helpful to have inline the smallest example of usage that you can demonstrate, while providing links to more sophisticated examples if they are too long to reasonably include in the README.
-
-## Support
-Tell people where they can go to for help. It can be any combination of an issue tracker, a chat room, an email address, etc.
-
-## Roadmap
-If you have ideas for releases in the future, it is a good idea to list them in the README.
-
-## Contributing
-State if you are open to contributions and what your requirements are for accepting them.
-
-For people who want to make changes to your project, it's helpful to have some documentation on how to get started. Perhaps there is a script that they should run or some environment variables that they need to set. Make these steps explicit. These instructions could also be useful to your future self.
-
-You can also document commands to lint the code or run tests. These steps help to ensure high code quality and reduce the likelihood that the changes inadvertently break something. Having instructions for running tests is especially helpful if it requires external setup, such as starting a Selenium server for testing in a browser.
-
-## Authors and acknowledgment
-Show your appreciation to those who have contributed to the project.
-
-## License
-For open source projects, say how it is licensed.
-
-## Project status
-If you have run out of energy or time for your project, put a note at the top of the README saying that development has slowed down or stopped completely. Someone may choose to fork your project or volunteer to step in as a maintainer or owner, allowing your project to keep going. You can also make an explicit request for maintainers.
+This course is intended for life scientists without any prior knowledge about bioinformatics/programming. The objective is to provide a sufficient amount of knowledge about Python to solve small problems by writing simple scripts. 
--- a/data/.gitkeep
+++ b/data/.gitkeep
--- a/data/AtCol0_Exons.fasta
+++ b/data/AtCol0_Exons.fasta
--- a/data/exerciseF_task1_4_sequence.fasta.txt
+++ b/data/exerciseF_task1_4_sequence.fasta.txt
+>SduTW12_06g132610.v1 mRNA Similar to THI1-1: Thiamine thiazole synthase 1, chloroplastic (Vitis vinifera) chr06:1951696-1954502(-)
+TTCTTTGTTAAATATTTAAATAGAATATGTTGATAAATCTTAAAGGCAGAGAGTACTGCA
+TGCTTTACAAGTGTTACTTATGGAGATAGATGTACATGATATTTTTCTCTCGCTCTCCAT
+ACTTGTCACTCGAGCCCCTATATAAATCCTTCCTCTTCCCCTTCCACTTGCTCACTCAAA
+AATCTCCGCTCTATTCCCAATTCCCAATTCTTCGAGCTTTCTCTATCAATGGCAACAATG
+GCTTCCACCTTGGCTTCCTCTGTTATTTCCAAGACTAATTTCCTTGACACACACAAATCA
+TCTTTCTATGGAGTACCAATTTCATCACAAGCTAGATTGAAAATTGTGAAATCAACCCCA
+CAGAATATGGCTGTTTCCATGTCTGCTGATGCTTCTCCTCCTCCTTACGATCTCGGAAGT
+TTCAGTTTTAATCCGATTAAGGAATCGATTGTTGCTCGGGAAATGACACGTAGGTACATG
+ACGGATATGATCACTTATGCGGATACTGATGTTGTTATTGTTGGTGCTGGATCTGCTGGT
+CTATCTTGTGCTTATGAGCTCAGCAAGAACCCTGATGTTCAGGTATGCCTTTTTTCTATA
+AAAAAAATTTATTTTATATATATATATGCATAGATATCGAAATTTAAGTTTGGTCGATTT
+GAAGTCTAAGAGTGATAAATCGCGATTTTAAACTAATATACAATAAAAATTGGGTGAACC
+Atagatatcagacttttatctgcaactgggatgtgatcccagtgttgatacatcatatgt
+tgcgctcttaacactagatcaaggCTCGGGAGACATGTCAATTAAATTTTAAAAGCAGAG
+ACGGGAAATTTTGCAGTTTGTGTTCTGTCGTCAATTGTGCTTCATATGTGTTACTGTTTG
+ATTTGACATGATTCGTGAGAAAAAACGAAGATTTTTAAAATTTGTTAATATAAAAATGCA
+ACCTTTTTTGGGGCTGAATTAAAAAATTGATAGATACTGTTTTACTTGTTTTTGATAGAT
+TATTGGCACATAGGTTTCCTATTAAAAGTATTTGCAACTTTACTCGTACCCATAAATCAT
+GTGACACTTTTTCCCTTAGGATTATTTGCTATTTGAGTGGGACCATTCAAGAGACAAAAG
+TATATATTAATTGGGAAAGTTGTTTATATGCTTGTGAACCAGTGAAATTGCTTTTAAGAA
+GTTGAGCTGATAACAATGAGTTTAATTGAATACACAGAGCCCGTCCTAGATCTGACTGTG
+TACACACATTCACGATTACAATGAAGTCAATTGATGTTCTAATTGCTATAATTGTCGTTG
+ATTGCAATATCAATGTTCTCCAATTTGAACTTGTGAGTTGTTTATGTGAATTGACTTTAT
+ATGTGTAGGTTGCCATCCTTGAGCAATCTGTGAGCCCTGGTGGAGGTGCCTGGCTAGGTG
+GACAACTCTTCTCAGCCATGGTTGTGCGTAAGCCAGCACATCTTTTCTTGAACGAGCTAG
+GCATTGATTACGACGAGCAAGACAACTACGTGGTCATTAAACACGCTGCCTTGTTCACCT
+CAACCATCATGAGCAAGCTTTTGGCCAGGCCAAATGTGAAGCTCTTTAATGCTGTTGCAA
+CAGAGGACCTTATCGTGAAGAACGGAAGAGTCGGTGGTGTTGTCACTAACTGGTCTTTAG
+TTTCCCAGAACCACGACACACAATCCTGCATGGACCCCAATGTTATGGAGGCTAAGGTTG
+TGGTCAGCTCCTGTGGCCACGATGGTCCCATGGGAGCCACTGGTGTTAAGAGGCTCAGGA
+GCATTGGCATGATCAACAGTGTTCCTGGAATGAAAGCTTTGGACATGAACGCTGCTGAGG
+ACGCGATTGTTAGACTTACCAGAGAAGTTGTACCTGGAATGATTGTTACAGGAATGGAAG
+TTGCTGAAATTGACGGAGCACCAAGAATGGTGAGTATATTTGTCACCACTCTTACTACTA
+TAAAGTAGTTGCACGTCTGTATTCTATGAACTCCTAATTTGCCTTACAACAAACAAGGCC
+AACTGTGCCTCAATCAGTCTCAAACAAGTTTGGGAGAAACTCCTAATTTTGCCTTAATAT
+AGCAAAATGGACACAAATGTTTCATACAGCCGATCTAATTTAGTTTTGCTAGTATAACTA
+ATTGGAAATGTTTTATATTGTTCAGGGTCCAACTTTTGGAGCCATGATGATATCAGGGCA
+GAAGGCAGCACACCTTGCCCTACGAGCGTTGGGATTGCCTAACGCCCTTGACGGAACTGC
+AGAAACAAGCATCCACCCGGAGCTTATGTTGGCTGCAGCTGATGAAGCTGAAACTGCTGA
+TGCTTGAATGTAATTTATAGTTTTCTAAGAAAGGATATGAAAAATATTAGTTTTTCCTAG
+ATGAGTATGGTTATGTGGTGGAGAGATAAATTGGCAAGGGGATGATTAATATAAGATCAG
+CAAGATGAATGTCTCTGTGTGCTTTGGTTGTCATGTCAATTCTTCTTTCTCTTTTGATTT
+AGTGAAACTTCTATGTGAAAAAAGTGGTAGATTGTTATTTTGGTCGTTGAATAATCCTAT
+GGGCCTTTTGGACTTTGTTTTGGTACTTGATGTGGTTTGGGTGAATGAACATTGTGATTG
+GGCCAAGATCTTTCTTTCTCGTATATATTGGGCATTTGCTCAATTGGTAAAAGGACTCTA
+ATTTAAAAAAACACACAGGTCAACTAGGCAATAAATAGGCAATAATACAACTGAGCAACG
+GATAGCCCATCAAATTGATACGTACAAACTTAGTGCACATACTAACC
+>SduTW12_06g132620.v1 mRNA Similar to GOS2: Protein translation factor SUI1 homolog (Oryza sativa subsp. japonica) chr06:1970033-1973436(-)
+CTCTTTATTAGCTGATTTCACATTATATTTTCCTTTTTTCTTCTGTGCACTGACTTTTCT
+GTATTTTGCTCAAGACTTATCCGGATTTTGGGGTCTGCTGTATTGCCACCGTCTTCAATC
+TCTACAAACCCTAACCTTCGGATCAGGTAAATCTTCAATACCCACTTGTTTTATTGGTTG
+ATAATCTTCAGATCTGGTGAATTAGCTTTGTTTGTTTGTCTAGTACTTGTTTTTGTTATA
+AAGATCGGATTTTTAATCCAAGAATTGGTAGAATTTTGGGGATTTTAGGCTTGAGATGTT
+GATTTATGATGCTTAGTGATAAAGATGGATTTTTATTCCAAGAATTGGTGGAATTTTGTG
+GCTAGAGATGCTGATTTATGATTATTAGTGATAAAGATCGGAtttttatgatgtccgtgt
+tgttccggtcagctttggctcacctggactaattccatggtatacctgccacctcatcac
+ctagtattttgtctctgttgggatttgaaccTTGGGTGCTTTGGTTGTTCTATGCTTTCT
+GTTATGATGCTTAGTGATAAATATTGGATTtttatgatgaccctgttgtttggatcagct
+ttcgcacacctagactaattccacggtatatctgttacctctgaccagcaacaactatca
+gataactctgtccatcaagtctaccaatgctagaatagatgggaaggatctcctaatgtt
+ttttctctgctgggatttgaatcttgggtgctatggttGTTCTTTGCTTGCTATTGTGAT
+GCTTATTGAATGATCTGGTTATATATTCATAGTAACTGGAACCGTTTTATGAAACTTTTA
+TATCAAAGTTGTGATTGGTACTGTTTTTGAAGAAGTTACTCTAGAGCTATGTACTTTTTC
+TGATGCAAGTTTTGATCTTTTTTCTTTTGGGTTGTTTTCTGTTGCAATAGTCTGGTCGTA
+TTTCTCCAAGAGTTGGAATCATTTAAGATTTTTAAAGTAGAGTTGTCCGTTTCTGATGCC
+TAGTTATTTTATTATGGGGGTGTGTTGTTTTGCTGAATTCTAGTTGTGTTTTCTCCAAGG
+ATTTTGATATCACTTTGGGATTTGTATGCTGTTTTTTATACTTATTATAGAATATCTGTT
+GTTTGTCTTACTCTGGTTGTTGGGGGGAACAAATGCGTGTGTAAGATTACCTTTCCAACC
+CTATTTGTGGTGAAGGATTATTTTTTCTGATGAATAAGtttctgtatttgattctctacc
+ttttttctttctttctttctgtttttGGTTTGGATATTGGATGGGCTTTTACCAGTTCTT
+TTGCCTCCTGTTGCTCTTAATACTAAAACATATGTGGATCGCCTCTTTCTATTGTACATA
+CGACATGCAAGATGATAATGGAATCTGTCGGAAGCTTTATCTTGTGTATTATGTTGTTGA
+TAAAAATTGGAATTTTCTGAAAGACTAGTACTATGCTGGTACTTTACTGCAAGCTGTCTC
+ATGTGTATTGTTTTGGTGATAAATAGAGTTGTTTTCTTTTCCAACTTTCTTGCTAATAAA
+GGTTTCTTCTTTCATCTGTTTATGTTTATGTCCTATTTAGCTTTTGATTGTCCTGTTTTT
+TAGACAGGGTGTTTGTATTGATAATCTGATACAGCTGCTTGTCTACTATATAGGATATTT
+AGATAACTCCTTGTCATTGTATGTATGCAAAATGATTAAATAGTCTACGTTGATGTTTGT
+CACTACTTGAGACGTGGAATTTGGTTTCTTGTTTATTCTTCTTGTTGTAATAGCTGCTGA
+GCTCTTTTTCATTTGCCTAGGTCTGAGCATCCAAGTTTCGAGATCTGTGTGCTCCTGTTG
+TCTTCTACTCTCAGCCAAGTTTCATGTCTGATCTCGACGTCCAAATTCCTACCGCTTTTG
+GTATGGGCCTCTCCTTAAATCACATTCTGTTTTAGTGCAATTTCGTGTATTTCCTGTCTT
+ATCAGATCAGTAAATCAGTTTCAGTTGAATGTTAAAAAAGTTCGGGTTCATGTTTTATAG
+AGGTGATAGTTTAGATGCAAAGAAAGAAAAGGGTTGAGAAGAAAGCATGCTAGTTCAGAG
+GATATGAATTATATTCTTATCTTCTATACCTGACCAGTCATGCTGCTTTATTATGCTTTA
+TAGATCCCTTTGCCGAGGCAAATGCTGATAACTCTGGTGCTGGGTCAAAAGATTACGTGC
+ACATCCGTATACAACAAAGGAATGGTAGGAAAAGCCTGACAACTGTGCAGGGGTTGAAGA
+AAGAATTCAGCTATAACAAGATACTGAAGGATCTTAAGAAAGAGTTCTGCTGCAATGGTA
+CTGTCGTTCAGGATCCTGAATTAGGCCAGGTTTGTAACTTTGCATTCCAGTGCCTCGTCT
+CTGTTATTGCAAGTTCTATGACTGATCTTATGTTTTTTGTTGTTTATGAAGGTTATTCAA
+CTTCAGGGTGACCAGCGGAAGAACGTTTCTACATTTCTTGTCCAGGTGAGTGTGGTGCAG
+ATTGAGCATGTCTTTTTGCTCGTTCAATATTAAGTTATCTTGCTATGATAAATAGATGCT
+TAAAAAAATCTTATGTCATGCATTAACAGTCATTTGTGAATATCACTGTTTCAGTTAACT
+TCTTCTGTCACTCCTGAATCGTGTCTTTTGAAGTGAAGTGGGTTAGTAATAGGCTGAGCT
+GCTCATTAAGCAAAAAAAAGACACTCTTTTGGTTCAGTGTTCATTTCGATATTGAGTGTA
+TGTACTGGAGTCACTTGTTACAGATTTACTGATCAAGGGCAGGAGGAGAGAATAGGCAAT
+GACAGAACTAACAGCACTACTAATTCTGTAGCTTGACTTAAATTGATATCTTATGGGACT
+CTCTGTTCCAAATTTTATAGTATTTATCTACTTTGTTGCTAATTTCTTCTTTTTGGATTT
+GTTGAAGCAGGCTGGAATTGTGAAGAAAGAGCACATCAAAATTCATGGTTTCTGATTGCT
+CTCATCAGCCTCAGCTGCACAGTTATCATACTTGTTATGTCAATGCCAGAGATAGGCTAT
+CCAAACTCAGTTCTACTAAAACTTACTAGTGTTTAATTTCTGCTGGTTTGATATAAACAC
+TGTATTTGCTTCTCTATGTTCCGTCTGAATATGAATCGTGTTATATTTTCGAGCACTTTA
+CGAACCAATGATGATATTATTGAGTGCTCAAGAGACATGATCCTTGTCATTTTGGGTTGT
+TGCTGATCGTCTAGTGCCGCTTAGAATTTACTGCATATGCAGCAGTTCTGGTTTACGTGC
+TTCAATACCATTTGTATCATTTGGGATCATTCTTGATTTGGTGGTTCTTGAAAGGCTATT
+GTTGGACTTTAGTATTGAGGAGTGGGGTTCATTCAATCTTTTAA
\ No newline at end of file
--- a/data/expression_human_chr1.txt
+++ b/data/expression_human_chr1.txt
--- a/data/expression_human_chr1_short.txt
+++ b/data/expression_human_chr1_short.txt
+#chrom	chromStart	chromEnd	name	strand	geneId	expScores
+chr1	11868	14403	DDX11L1	+	ENSG00000223972.5	0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.166,0,0,0,0,
+chr1	14409	29553	WASH7P	-	ENSG00000227232.5	4.064,3.371,2.686,4.048,3.901,3.64,5.164,1.438,1.693,1.566,4.992,5.721,2.483,2.147,1.686,1.748,1.539,1.442,2.73,1.742,4.439,2.494,1.679,5.629,7.098,4.648,3.595,4.326,3.117,4.103,6.134,1.52,0.925,2.771,2.215,1.765,4.508,3.527,1.417,6.685,6.634,1.808,5.425,7.083,5.933,6.133,4.194,5.926,3.062,4.703,6.273,7.19,5.745,2.647,
+chr1	17368	17436	MIR6859-1	-	ENSG00000278267.1	0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
+chr1	29570	31109	MIR1302-2HG	+	ENSG00000243485.5	0,0,0,0,0,0,0,0,0,0.024,0,0,0.027,0.03,0,0.025,0.031,0.023,0,0.02,0,0,0,0,0,0,0,0,0,0,0,0,0.018,0.018,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.054,0,0,0,0,
+chr1	34553	36081	FAM138A	-	ENSG00000237613.2	0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
+chr1	52472	53312	OR4G4P	+	ENSG00000268020.3	0,0,0.036,0,0,0,0.035,0.05,0.054,0.046,0.025,0.037,0.043,0.042,0.053,0.04,0.045,0.048,0.042,0.047,0.03,0,0,0,0.024,0.015,0.033,0.036,0,0,0,0.036,0.051,0.039,0,0.033,0,0,0.038,0,0,0,0,0.021,0.027,0,0.035,0,0.033,0,0,0,0,0,
+chr1	62947	63887	OR4G11P	+	ENSG00000240361.1	0.041,0.041,0.054,0.029,0,0.039,0,0.064,0.068,0.072,0.047,0.05,0.07,0.073,0.077,0.064,0.059,0.065,0.057,0.066,0.039,0,0,0.051,0,0.043,0.045,0.041,0.023,0.043,0.036,0.06,0.073,0.058,0,0.043,0.039,0.033,0.054,0,0,0,0.029,0.042,0.043,0.042,0.04,0,0.047,0.054,0.039,0.016,0.027,0,
+chr1	69090	70008	OR4F5	+	ENSG00000186092.4	0.045,0.045,0.058,0,0.041,0.044,0.044,0.079,0.077,0.083,0.06,0.058,0.084,0.074,0.103,0.083,0.081,0.099,0.071,0.073,0.046,0.031,0,0.041,0,0.045,0.05,0.048,0.038,0.049,0,0.083,0.098,0.076,0.026,0.061,0.043,0.032,0.064,0.039,0,0.025,0.037,0.043,0.049,0.046,0.043,0.036,0.054,0.039,0.049,0,0.015,0,
+chr1	89294	129223	RP11-34P13.7	-	ENSG00000238009.6	0.018,0.021,0.016,0,0.008,0,0.015,0.019,0.021,0.019,0.022,0.023,0.024,0.025,0.02,0.019,0.02,0.016,0.017,0.019,0.023,0.009,0,0,0.024,0.016,0.016,0.018,0.024,0.016,0,0.016,0.016,0.017,0,0.017,0.035,0.02,0.014,0.019,0.03,0.015,0.025,0.029,0.019,0.019,0.017,0.083,0.017,0.334,0.023,0.026,0.025,0.096,
+chr1	131024	134836	CICP27	+	ENSG00000233750.3	0.019,0.038,0.015,0.024,0.021,0.012,0.016,0.015,0.018,0.018,0.029,0.036,0.02,0.019,0.014,0.024,0.022,0.015,0.024,0.016,0.028,0.017,0,0.055,0.07,0.013,0.018,0.022,0.116,0.018,0.035,0.014,0.011,0.019,0.088,0.023,0.132,0.046,0.005,0.015,0.099,0.029,0.085,0.064,0.026,0.026,0.03,0.454,0.025,0.277,0.058,0.039,0.072,0.795,
\ No newline at end of file
--- a/data/genes_human_chr1.txt
+++ b/data/genes_human_chr1.txt
--- a/data/genes_human_genenames_duplicates.txt
+++ b/data/genes_human_genenames_duplicates.txt
--- a/data/human_genes_alignment_identities.txt
+++ b/data/human_genes_alignment_identities.txt
+gene_name	alignment_identity
+DDX11L1	76.4
+NOC2L	32.4
+PANK4	90.6
+ADGRB2	56.9
+IRF5	89.5
+CPA1	75.0
+CEP41	93.3
+DGKI	44.4
+HIPK2	39.7
+TBXAS1	88.8
+SLC37A3	47.9
+BRAF	64.8
+AGK	99.9
+WEE2	100
+SSBP1	58.3
+CLEC5A	82.1
+MGAM	56.9
+TRBV7-7	99.8
+EPHB6	96.0
+TRPV6	65.5
+TRPV5	87.0
+LLCFC1	76.9
+KEL	50.4
+OR9A2	100
+PIP	90.4
+TAS2R39	99.1
+GSTK1	84.2
+TMEM139	77.7
+CASP2	24.8
+HINT1P1	68.9
+CLCN1	90.7
+FAM131B	92.3
+MIR6892	88.5
+ZYX	79.9
+EPHA1	81.4
+TTN	90.5
\ No newline at end of file
--- a/data/raw_variants.txt
+++ b/data/raw_variants.txt
No results found